Sekwencja rozpoznawania

Sekwencja rozpoznawania jest sekwencją DNA, do której motyw strukturalny domeny wiążącej DNA wykazuje swoistość wiązania. Sekwencje rozpoznawcze to palindromy.

czynnik transkrypcyjny Sp1, na przykład, wiąże sekwencje 5′-(g/T)GGGCGG(G/A)(G/A)(C/T)-3′, gdzie (G/T) oznacza, że domena wiąże guaninę lub tyminę w tej pozycji.

endonukleaza restrykcyjna psti rozpoznaje, wiąże i rozszczepia sekwencję 5′-CTGCAG-3′.

Sekwencja rozpoznawania różni się od miejsca rozpoznawania. Dana Sekwencja rozpoznawania może wystąpić jeden lub więcej razy, lub wcale, na określonym fragmencie DNA. Witryna rozpoznawania jest określona przez pozycję witryny. Na przykład istnieją dwa miejsca rozpoznawania PstI w następującym fragmencie sekwencji DNA, zaczynając odpowiednio od zasady 9 i 31. Sekwencja rozpoznawania jest sekwencją specyficzną, zwykle bardzo krótką (mniej niż 10 zasad). W zależności od stopnia specyficzności białka, białko wiążące DNA może wiązać się z więcej niż jedną określoną sekwencją. Dla PstI, który ma swoistość pojedynczej sekwencji, jest to 5 ’- CTGCAG-3′. Zawsze jest tak samo, czy w pierwszym miejscu rozpoznawania, czy w drugim w następującej sekwencji przykładowej. Dla Sp1, który ma wielokrotną (16) swoistość sekwencji, jak pokazano powyżej, dwa miejsca rozpoznawania w poniższym przykładowym fragmencie sekwencji są w 18 i 32, a ich odpowiednimi sekwencjami rozpoznawania są 5′-GGGGCGGGAGC-3′ i 5′-TGGGCGGAAC-3′.

5 ’- aacgttagctgcagtcgggggggagctaggctgcaggaattgggcggaacct-3′

Dodaj komentarz

Twój adres e-mail nie zostanie opublikowany.